Question at position 67 Translate the template DNA sequence into protein as a ribosome would. I recommend working this out on scrap paper, then finding the answer. Template DNA: 5'-TTTAAAACACCCACCGATGTGTCATT-3'N-Met-Cys-His-CN-Lys-Phe-Cys-Gly-Trp-His-His-Ser-CN-Met-Thr-His-Arg-Trp-Val-Phe-CNo protein is madeN-Met-Thr-His-Arg-Trp-Val-Phe-Trp-C

Question

BlackTom AI · Accepted Answer

We are asked to translate the given template DNA sequence into a protein as a ribosome would, i.e., determine whether translation can start and what amino acid sequence would be produced. To reason through the options, we should examine the presence of a start codon (AUG) in the mRNA derived from the template DNA, since translation begins at AUG and proceeds codon by codon.

Option 1: N-Met-Cys-His-C
- This sequence would require an AUG start and a continuing codon track that yields Met, Cys, His, etc. If the template DNA lacks a proper start codon (AUG in the mRNA), translation cannot initiate, so this option presumes a start that may not exist. Without verifying AUG in the transcribed mRNA, we cannot accept this as correct.

Option 2: N-Lys-Phe-Cys-Gly-Trp-His-His-Ser-C
- For this peptide, the transcript would need to begin with AUG (Met) and then proceed through codons to yield Lys, Phe, etc. However, even if the codon sequence could yield this chain, the absence of an initial start signal (AUG) or the presence of premature stop signals or incompatible reading frame would prevent synthesis. This option relies on an initialization that may not be present.

Option 3: N-Met-Thr-His-Arg-Trp-Val-Phe-C
- This option also implies a start codon (Met) and a continuous reading frame. If the template DNA does not provide a proper initiation context or if the reading frame is disrupted by noncoding segments or a premature stop, translation would not proceed to produce this exact sequence.

Option 4: No protein is made
- This option states that translation does not occur at all. If the transcribed mRNA lacks the canonical start codon (AUG) in the correct reading frame, the ribosome cannot begin translation, so no protein would be synthesized. This is a plausible outcome when the template DNA does not encode a suitable initiation signal for translation.

Option 5: N-Met-Thr-His-Arg-Trp-Val-Phe-Trp-C
- Similar to the other peptide options, this would require a valid start codon and a coherent reading frame. If such initiation and frame maintenance are not present in the template, this sequence cannot be produced.

Key reasoning to distinguish these options:
- Translation requires an initiation codon (AUG) in the mRNA produced from the template DNA. If the given template DNA sequence does not yield an mRNA with a proper AUG start in the correct frame, no polypeptide will be synthesized.
- Even if there are in-frame codons downstream, without initiation, the ribosome cannot start translating, so any proposed peptide sequence would be invalid.
- Several options propose specific amino acid chains starting with Met, which presumes an AUG start. If the template lacks a start signal or the reading frame is broken, those chains cannot form.

Thus, the option asserting that no protein is made corresponds to the scenario where there is no valid initiation signal (AUG) in the transcribed mRNA, preventing translation altogether. The remaining options all hinge on an initiation event that may not occur with the given template DNA, making them incorrect under the assumed translation conditions.

View Explanation

Log in for full answers

Similar Questions

Question at position 79 In both prokaryotes and eukaryotes, how many ribosomes can translate an mRNA at a time?twothreemanyone

A gene in the DNA Template Strand sequence is provided below. 3′ −G-G-A-A-C-G-T-A-C-T-A-A-C-G-G-A-C-T-A-T−5′ Given this sequence, what is the resulting amino acid sequence of the polypeptide following translation at the ribosome?

What amino acid sequence will be generated based on the following mRNA codon sequence? 5′-AUG-UCU-UCG-UUA-UCC-UUG-3′

Type the single letter amino acid sequence that this gene encodes

How many amino acids are produced from this mRNA sequence AUAAUGUUUGGGCCCUUUUAGAAAAAA

More Practical Tools for Students Powered by AI Study Helper

Homework AI Solver

Stylized AI Paper Writer

Plagiarism Checker Assistant

Citation AI Academic Writing Tool

In-Class Translation Assistant

AI Note Generator

AI Quiz Answers

Past Exam Questions from University Test Bank

Smart Practice Assistant

Adaptive Practice

Making Your Study Simpler