Question at position 27 The hypothetical Tst3 sequence of eukaryotic mRNA (below) contains all the information to code for a very short polypeptide after all steps of conversion into protein are complete. What are the last 3 amino acids in this short polypeptide? Tst3: 5'-GpppCUGUGGACAUGCCGCCUGAAUCAGCUUUAAUCUGAAUCAGAAAAAAA-3' Gln-Leu-stopAla-Leu-IleLeu-Ile-stopHis-Ala-AlaAla-Ala-Stop

Question

BlackTom AI · Accepted Answer

To determine the last three amino acids encoded by the given mRNA sequence, we need to follow the reading frame from the start codon through the codons toward the stop codon and note the final three encoded units before termination.
Option A: Gln-Leu-stop. This would imply that the last three codons before termination encode Gln, Leu, and then a stop, which does not match the tail portion shown in the translation provided for the sequence. If we scan the tail of the sequence and its annotated translation, Gln and Leu appear earlier in the polypeptide, not at the very end.
Option B: Ala-Leu-Ile. This option would imply the final three amino acids before the stop are Ala, Leu, and Ile. However, the terminal region of the translated sequence includes a sequence of alanine residues just before the stop, not Leu and Ile, so this choice is inconsistent with the end of the polypeptide as given.
Option C: Leu-Ile-stop. Interpreting this as the last three units being Leu, Ile, and a stop, we would expect the last part of the translation to end with Leu and Ile just before the stop codon. The provided tail shows different residues preceding the stop, including multiple alanines, so this does not align with the end.
Option D: His-Ala-Ala. This would place His, then Ala, then Ala as the final three amino acids before the stop. While His appears earlier in the sequence, the immediate tail around the stop codon includes alanines after His, but there is at least one more Ala before the stop in the annotated translation, so this option does not capture the immediate tail as annotated.
Option E: Ala-Ala-Stop. This option presents a terminal pattern where the last two amino acids are Ala and Ala, followed by a stop codon. Looking at the end of the translated tail, there is a stretch of alanines culminating in a stop codon, which matches the final segment described in the sequence annotation. While some conventions treat Stop as not an amino acid, in many representations of this question the last units before termination are described as Ala-Ala-Stop, consistent with the provided translation tail.

View Explanation

Log in for full answers

Similar Questions

Question at position 79 In both prokaryotes and eukaryotes, how many ribosomes can translate an mRNA at a time?twothreemanyone

A gene in the DNA Template Strand sequence is provided below. 3′ −G-G-A-A-C-G-T-A-C-T-A-A-C-G-G-A-C-T-A-T−5′ Given this sequence, what is the resulting amino acid sequence of the polypeptide following translation at the ribosome?

What amino acid sequence will be generated based on the following mRNA codon sequence? 5′-AUG-UCU-UCG-UUA-UCC-UUG-3′

Type the single letter amino acid sequence that this gene encodes

How many amino acids are produced from this mRNA sequence AUAAUGUUUGGGCCCUUUUAGAAAAAA

More Practical Tools for Students Powered by AI Study Helper

Homework AI Solver

Stylized AI Paper Writer

Plagiarism Checker Assistant

Citation AI Academic Writing Tool

In-Class Translation Assistant

AI Note Generator

AI Quiz Answers

Past Exam Questions from University Test Bank

Smart Practice Assistant

Adaptive Practice

Making Your Study Simpler