Questions
SMC 2025 Spr - BIOL 3 (1286,1288) - Fundamentals of Biology (G) Quiz 9 DNA
Single choice
How many amino acids are produced from this mRNA sequence AUAAUGUUUGGGCCCUUUUAGAAAAAA
Options
A.5
B.7
C.9
View Explanation
Verified Answer
Please login to view
Step-by-Step Analysis
To determine how many amino acids are produced, we need to identify the open reading frame starting at the first AUG start codon and then count the codons up to the first stop codon.
Option 1: 5
- The sequence contains AUG at positions 4-6, which is the start codon. Translating from AUG onward, the codons are AUG, UUU, GGG, CCC, UUU, and then a stop co......Login to view full explanationLog in for full answers
We've collected over 50,000 authentic exam questions and detailed explanations from around the globe. Log in now and get instant access to the answers!
Similar Questions
Question at position 67 Translate the template DNA sequence into protein as a ribosome would. I recommend working this out on scrap paper, then finding the answer. Template DNA: 5'-TTTAAAACACCCACCGATGTGTCATT-3'N-Met-Cys-His-CN-Lys-Phe-Cys-Gly-Trp-His-His-Ser-CN-Met-Thr-His-Arg-Trp-Val-Phe-CNo protein is madeN-Met-Thr-His-Arg-Trp-Val-Phe-Trp-C
Question at position 64 Translate the coding DNA sequence into protein as a ribosome would. I recommend working this out on scrap paper, then finding the answer. Coding DNA: 5'-GCACTATGCCCCTGCGGGGATGAGTA-3'N-Met-Pro-Leu-Arg-Gly-CN-Ala-Leu-Cys-Pro-Cys-Gly-Asp-Glu-CN-Met-Pro-Leu-Arg-Gly-Trp-CNo protein is madeN-Met-Ser-Arg-Gly-Val-Pro-Val-C
Question at position 79 In both prokaryotes and eukaryotes, how many ribosomes can translate an mRNA at a time?twothreemanyone
A gene in the DNA Template Strand sequence is provided below. 3′ −G-G-A-A-C-G-T-A-C-T-A-A-C-G-G-A-C-T-A-T−5′ Given this sequence, what is the resulting amino acid sequence of the polypeptide following translation at the ribosome?
More Practical Tools for Students Powered by AI Study Helper
Making Your Study Simpler
Join us and instantly unlock extensive past papers & exclusive solutions to get a head start on your studies!