How many amino acids are produced from this mRNA sequence
AUAAUGUUUGGGCCCUUUUAGAAAAAA

Question

BlackTom AI · Accepted Answer

To determine how many amino acids are produced, we need to identify the open reading frame starting at the first AUG start codon and then count the codons up to the first stop codon.

Option 1: 5
- The sequence contains AUG at positions 4-6, which is the start codon. Translating from AUG onward, the codons are AUG, UUU, GGG, CCC, UUU, and then a stop codon UAG at positions 19-21. This yields five codons that are translated (AUG counts as one codon, encoding methionine, plus four additional codons). Therefore, five amino acids would be produced (including the start amino acid).

Option 2: 7
- If one assumed additional codons beyond the stop, this would require either a longer ORF or a stop codon later in the frame. In the given sequence, the first stop codon encountered is UAG at positions 19-21, which terminates translation before more codons could be read. Thus, seven amino acids is not supported by this reading frame.

Option 3: 9
- Similarly, counting to nine would require continuing translation past the first stop codon. Since UAG appears after the fifth codon (AUG, UUU, GGG, CCC, UUU) and signals termination, translation does not proceed to encode more amino acids in this frame. Therefore, nine amino acids is incorrect for this sequence in the standard interpretation.

Additional notes:
- It’s important to align codons in frame starting at the first AUG to identify the correct reading frame.
- A stop codon (UAG) terminates translation, so codons after the stop are not translated, which is why longer counts (7 or 9) do not apply here.
- If one did not locate the start codon first or misaligned the frame, one could erroneously count different numbers of codons, but proper analysis shows the frame yields five amino acids total before the stop.

SMC 2025 Spr - BIOL 3 (1286,1288) - Fundamentals of Biology (G) Quiz 9 DNA

How many amino acids are produced from this mRNA sequence AUAAUGUUUGGGCCCUUUUAGAAAAAA

View Explanation

Log in for full answers

Similar Questions

Question at position 79 In both prokaryotes and eukaryotes, how many ribosomes can translate an mRNA at a time?twothreemanyone

A gene in the DNA Template Strand sequence is provided below. 3′ −G-G-A-A-C-G-T-A-C-T-A-A-C-G-G-A-C-T-A-T−5′ Given this sequence, what is the resulting amino acid sequence of the polypeptide following translation at the ribosome?

What amino acid sequence will be generated based on the following mRNA codon sequence? 5′-AUG-UCU-UCG-UUA-UCC-UUG-3′

Type the single letter amino acid sequence that this gene encodes

More Practical Tools for Students Powered by AI Study Helper

Homework AI Solver

Stylized AI Paper Writer

Plagiarism Checker Assistant

Citation AI Academic Writing Tool

In-Class Translation Assistant

AI Note Generator

AI Quiz Answers

Past Exam Questions from University Test Bank

Smart Practice Assistant

Adaptive Practice

Making Your Study Simpler