A gene in the DNA Template Strand sequence is provided below.

3′ −G-G-A-A-C-G-T-A-C-T-A-A-C-G-G-A-C-T-A-T−5′

Given this sequence, what is the resulting amino acid sequence of the polypeptide following translation at the ribosome?

Question

A gene in the DNA Template Strand sequence is provided below.

3′ −G-G-A-A-C-G-T-A-C-T-A-A-C-G-G-A-C-T-A-T−5′

Given this sequence, what is the resulting amino acid sequence of the polypeptide following translation at the ribosome?

BlackTom AI · Accepted Answer

First, let's interpret the given DNA template strand and determine the mRNA sequence that would be produced during transcription. The template strand is read 3' to 5', so the corresponding mRNA is synthesized 5' to 3' and is complementary to the template: G pairs with C, A with U, T with A, and C with G. Reading the template from 3' to 5' and substituting, the mRNA sequence (5' to 3') becomes CCUUGCAUGAUUGCCUGAUA.

Now, translating the mRNA from the start codon (AUG) in the correct reading frame: the first codon that codes for an amino acid is AUG, which specifies Methionine (Met). After Met, the next codon is AUU, which codes for Isoleucine (Ile). The following codon is GCC, which codes for Alanine (Ala). The next codon encountered is UGA, which is a stop codon and terminates translation. Because translation stops at a stop codon, any codons downstream are not translated, and the polypeptide ends after the Ala.

Now let's evaluate each option:
- Option 1: Met−Ile−Ala. This sequence corresponds exactly to the amino acids encoded from AUG (Met), AUU (Ile), and GCC (Ala) before reaching the stop codon UGA. This matches the translation timeline derived from the mRNA sequence. 
- Option 2: Arg−Cys−Met−Ile−Ala−Pro. This sequence does not align with the codons we have. There is no codon that translates to Arginine (Arg) or Cysteine (Cys) in the early portion of this reading frame, and the presence of six residues here contradicts the stop codon that terminates translation earlier. 
- Option 3: Ala−Pro−Tyr−Arg. This progression would require codons for Alanine, Proline, Tyrosine, and Arginine in that order, which is not what the mRNA codons yield in this frame after AUG is encountered. The initial amino acid is Met, not Ala, so this sequence is inconsistent from the start. 
- Option 4: Met−His−Leu−Arg. This would correspond to a different set of codons (for example, AUG for Met, followed by CAC for His, CUG for Leu, CGN for Arg in some contexts), which does not match the actual codons present in the given mRNA sequence, especially since the second codon here would need to be CAC, which is not AUU in the transcribed mRNA.

By comparing all options, the only sequence that aligns with the actual translation starting at AUG and proceeding through AUU (Ile) and GCC (Ala) before hitting the stop codon UGA is Met−Ile−Ala. The other sequences require codons that are not present in the given mRNA reading frame or ignore the stop signal, leading to incorrect protein compositions.

Bio 93 Section CDE 2025 Midterm 2- Section E

A gene in the DNA Template Strand sequence is provided below. 3′ −G-G-A-A-C-G-T-A-C-T-A-A-C-G-G-A-C-T-A-T−5′ Given this sequence, what is the resulting amino acid sequence of the polypeptide following translation at the ribosome?

View Explanation

Log in for full answers

Similar Questions

Question at position 79 In both prokaryotes and eukaryotes, how many ribosomes can translate an mRNA at a time?twothreemanyone

What amino acid sequence will be generated based on the following mRNA codon sequence? 5′-AUG-UCU-UCG-UUA-UCC-UUG-3′

Type the single letter amino acid sequence that this gene encodes

How many amino acids are produced from this mRNA sequence AUAAUGUUUGGGCCCUUUUAGAAAAAA

More Practical Tools for Students Powered by AI Study Helper

Homework AI Solver

Stylized AI Paper Writer

Plagiarism Checker Assistant

Citation AI Academic Writing Tool

In-Class Translation Assistant

AI Note Generator

AI Quiz Answers

Past Exam Questions from University Test Bank

Smart Practice Assistant

Adaptive Practice

Making Your Study Simpler